NovoPro
Cart 2
  • IFT22 Macaca fascicularis  cDNA/ORF Clones

IFT22 Macaca fascicularis cDNA/ORF Clones

Cat.#: 700036-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    intraflagellar transport 22
  • Organism
    Macaca fascicularis
  • Entrez Gene ID
  • Gene Symbol
    IFT22
  • Gene Type
    protein coding
  • Also Known as
    RABL5
  • Encoded Protein Alias
    intraflagellar transport protein 22 homolog; Rab-like protein 5
  • Product Name
    IFT22(XM_005549301) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca fascicularis intraflagellar transport 22 (IFT22), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    468
  • DataSheet:
  • Product Name
    IFT22(NM_001283136) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca fascicularis intraflagellar transport 22 (IFT22), mRNA.
  • Synonyms
  • ORF length
    558
  • DataSheet:
  • Product Name
    IFT22(XM_005549302) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca fascicularis intraflagellar transport 22 (IFT22), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    327
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"