NovoPro
Cart 2
  • PPM1A Human  cDNA/ORF Clones

PPM1A Human cDNA/ORF Clones

Cat.#: 712463-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 236.5 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein phosphatase, Mg2+/Mn2+ dependent 1A
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PPM1A
  • Gene Type
    protein coding
  • Also Known as
    PP2CA; PP2Calpha; PP2C-ALPHA
  • Encoded Protein Alias
    protein phosphatase 1A; protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform
  • Product Name
    PPM1A(XM_017021381) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1380
  • siRNA

    GACUUGAAGUCACUGAUGAtt

    GGAUGUUAUGGGAAAUGAAtt

    CCAAUAACCAGGAUUUUAAtt

  • DataSheet:
  • Product Name
    PPM1A(XM_017021383) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1227
  • siRNA

    GACUUGAAGUCACUGAUGAtt

    GGAUGUUAUGGGAAAUGAAtt

    CCAAUAACCAGGAUUUUAAtt

  • DataSheet:
  • Product Name
    PPM1A(NM_177952) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1368
  • Annotation
    This variant (3) has an alternate 5' exon, as compared to variant 1. It encodes isoform 3, which has a distinct and longer N-terminus, as compared to isoform 1.
  • siRNA

    GACUUGAAGUCACUGAUGAtt

    GGAUGUUAUGGGAAAUGAAtt

    CCAAUAACCAGGAUUUUAAtt

  • DataSheet:
  • Product Name
    PPM1A(XM_017021382) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1311
  • siRNA

    GACUUGAAGUCACUGAUGAtt

    GGAUGUUAUGGGAAAUGAAtt

    CCAAUAACCAGGAUUUUAAtt

  • DataSheet:
  • Product Name
    PPM1A(NM_177951) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1A (PPM1A), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    975
  • Annotation
    This variant (2) has an additional exon within the 5' UTR and lacks a few of 3' exons but has an alternate 3' segment, as compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1.
  • siRNA

    GACUUGAAGUCACUGAUGAtt

    GGAUGUUAUGGGAAAUGAAtt

    CCAAUAACCAGGAUUUUAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"