NovoPro
Cart 2
  • Prmt5 Mouse  cDNA/ORF Clones

Prmt5 Mouse cDNA/ORF Clones

Cat.#: 707731-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 348.5 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein arginine N-methyltransferase 5
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Prmt5
  • Gene Type
    protein coding
  • Also Known as
    Jbp1; Skb1
  • Encoded Protein Alias
    protein arginine N-methyltransferase 5; Jak-binding protein 1; SKB1 homolog; histone-arginine N-methyltransferase PRMT5; shk1 kinase-binding protein 1 homolog
  • Product Name
    Prmt5(NM_001313906) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein arginine N-methyltransferase 5 (Prmt5), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1857
  • Annotation
    This variant (2) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    Prmt5(NM_013768) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein arginine N-methyltransferase 5 (Prmt5), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1914
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    GCAUUUUCCUAACCAACAAtt

    CGCUAAUUGUGGGAAAGCUtt

    GCAGGCUAUUUAUAAAUGUtt

  • DataSheet:
  • DataSheet:
  • Product Name
    Prmt5(NM_001313907) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein arginine N-methyltransferase 5 (Prmt5), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1596
  • Annotation
    This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"