Cart 2
  • PSMA3 Human  cDNA/ORF Clone

PSMA3 Human cDNA/ORF Clone

Cat.#: 712439-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    proteasome subunit alpha 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PSMA3
  • Gene Type
    protein coding
  • Also Known as
    HC8; PSC3
  • Encoded Protein Alias
    proteasome subunit alpha type-3; macropain subunit C8; multicatalytic endopeptidase complex subunit C8; proteasome component C8; proteasome subunit C8
  • Product Name
    PSMA3(NM_152132) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens proteasome subunit alpha 3 (PSMA3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    747
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a shorter protein (isoform 2).
  • siRNA

    GGUUCCAACAAAAGACUUUtt

    GGUGCGCAACUCUACAUGAtt

    GACCUGCCGUGAUAUCGUUtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"