NovoPro
Cart 2
  • PRSS36 Human  cDNA/ORF Clones

PRSS36 Human cDNA/ORF Clones

Cat.#: 702760-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 328.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protease, serine 36
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PRSS36
  • Gene Type
    protein coding
  • Encoded Protein Alias
    polyserase-2; polyserase 2; polyserine protease 2; polyserine protease-2; serine protease 36
  • Product Name
    PRSS36(XM_017022969) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protease, serine 36 (PRSS36), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1914
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(XM_017022971) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protease, serine 36 (PRSS36), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1866
  • siRNA

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(XM_011545758) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protease, serine 36 (PRSS36), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1893
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(NM_173502) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protease, serine 36 (PRSS36), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2568
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(NM_001258290) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protease, serine 36 (PRSS36), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2553
  • Annotation
    This variant (2) uses an alternate splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(XM_017022968) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protease, serine 36 (PRSS36), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2286
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(XM_017022970) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens protease, serine 36 (PRSS36), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1905
  • siRNA

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Product Name
    PRSS36(NM_001258291) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens protease, serine 36 (PRSS36), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2259
  • Annotation
    This variant (3) lacks an alternate exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
  • siRNA

    CAACAGUGCCUUACAUUGAtt

    GCUGCUUUCUGGACCCGAAtt

    GCUGCUCACUGUUUCAUGAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"