NovoPro
Cart 2
  • Prkaa1 Mouse  cDNA/ORF Clones

Prkaa1 Mouse cDNA/ORF Clones

Cat.#: 743139-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 323.5 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein kinase, AMP-activated, alpha 1 catalytic subunit
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Prkaa1
  • Gene Type
    protein coding
  • Also Known as
    AI194361; AI450832; AL024255; AMPKalpha1; C130083N04Rik
  • Encoded Protein Alias
    ACACA kinase; AMP-activated protein kinase, alpha 1 catalytic subunit; AMPK subunit alpha-1; HMGCR kinase; acetyl-CoA carboxylase kinase; hydroxymethylglutaryl-CoA reductase kinase; tau-protein kinase PRKAA1
  • Product Name
    Prkaa1(NM_001013367) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein kinase, AMP-activated, alpha 1 catalytic subunit (Prkaa1), mRNA.
  • Synonyms
    XM_139298  
  • ORF length
    1680
  • siRNA

    GAGUGACUCUGAUGCCGAAtt

    CGGGAUCCAUCAGCAACUAtt

    GUUCAACCAUGAUCGAUGAtt

  • DataSheet:
  • Product Name
    Prkaa1(XM_017316356) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein kinase, AMP-activated, alpha 1 catalytic subunit (Prkaa1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1377
  • siRNA
  • DataSheet:
  • Product Name
    Prkaa1(XM_006519953) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein kinase, AMP-activated, alpha 1 catalytic subunit (Prkaa1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1248
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"