NovoPro
Cart 2
  • PRKAA1 Pongo abelii  cDNA/ORF Clones

PRKAA1 Pongo abelii cDNA/ORF Clones

Cat.#: 720400-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 249.9 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein kinase AMP-activated catalytic subunit alpha 1
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    PRKAA1
  • Gene Type
    protein coding
  • Encoded Protein Alias
    ACACA kinase; AMPK subunit alpha-1; HMGCR kinase; acetyl-CoA carboxylase kinase; hydroxymethylglutaryl-CoA reductase kinase; tau-protein kinase PRKAA1
  • Product Name
    PRKAA1(NM_206907) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1725
  • siRNA

    GGAUCCAUCAUAUAGUUCAtt

    GAGUCUACAGUUAUACCAAtt

    CGGGAUCAGUUAGCAACUAtt

  • DataSheet:
  • Product Name
    PRKAA1(NM_001133777) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii protein kinase AMP-activated catalytic subunit alpha 1 (PRKAA1), mRNA.
  • Synonyms
  • ORF length
    1653
  • siRNA
  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"