NovoPro
Cart 2
  • Ppm1a Rat  cDNA/ORF Clones

Ppm1a Rat cDNA/ORF Clones

Cat.#: 747161-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 196.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein phosphatase, Mg2+/Mn2+ dependent, 1A
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ppm1a
  • Gene Type
    protein coding
  • Also Known as
    Pp2c1
  • Encoded Protein Alias
    IA; PP2C-alpha; Protein phosphatase type 1A (formely 2C) Mg-dependent alpha isoform; Protein phosphatase type 1A (formely 2C), Mg-dependent, alpha isoform; protein phosphatase 1A, magnesium dependent, alpha isoform; protein phosphatase 2C isoform alpha; protein phosphatase IA
  • Product Name
    Ppm1a(NM_017038) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus protein phosphatase, Mg2+/Mn2+ dependent, 1A (Ppm1a), mRNA.
  • Synonyms
  • ORF length
    1149
  • siRNA

    GCCGUUUACAAUAGACUGAtt

    GAAACACGGUGCAGAUAGAtt

    GGUCAUUCUUUGCUGUAUAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"