Cart 2
  • PPARG Pig  cDNA/ORF Clone

PPARG Pig cDNA/ORF Clone

Cat.#: 736153-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 244.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    peroxisome proliferator activated receptor gamma
  • Organism
    Pig
  • Entrez Gene ID
  • Gene Symbol
    PPARG
  • Gene Type
    protein coding
  • Encoded Protein Alias
    PPAR-gamma; nuclear receptor subfamily 1 group C member 3; peroxisome proliferator activated receptor gamma; peroxisome proliferator activatived receptor gamma; peroxisome proliferator-activated receptor gamma 1; peroxisome proliferator-activated receptor gamma 2
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"