NovoPro
Cart 2
  • NECTIN2 Human  cDNA/ORF Clones

NECTIN2 Human cDNA/ORF Clones

Cat.#: 712296-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 196.8 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    nectin cell adhesion molecule 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NECTIN2
  • Gene Type
    protein coding
  • Also Known as
    HVEB; PRR2; CD112; PVRL2; PVRR2
  • Encoded Protein Alias
    nectin-2; herpesvirus entry protein B; poliovirus receptor-like 2
  • Product Name
    NECTIN2(NM_002856) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens nectin cell adhesion molecule 2 (NECTIN2), transcript variant alpha, mRNA.
  • Synonyms
  • ORF length
    1440
  • Annotation
    This variant (alpha) has multiple differences in the coding region, compared to variant delta, one of which results in an early stop codon. The resulting protein (isoform alpha) has a distinct C-terminus and is shorter than isoform delta.
  • siRNA

    GCUAUGAUGACAACUGGUAtt

    CGCUGAGCAGGUCAUCUUUtt

    GGCUAUGACUGGAGCACGAtt

  • DataSheet:
  • Product Name
    NECTIN2(XM_011527192) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens nectin cell adhesion molecule 2 (NECTIN2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1110
  • siRNA

    GCUAUGAUGACAACUGGUAtt

    CGCUGAGCAGGUCAUCUUUtt

    GGCUAUGACUGGAGCACGAtt

  • DataSheet:
  • Product Name
    NECTIN2(NM_001042724) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens nectin cell adhesion molecule 2 (NECTIN2), transcript variant delta, mRNA.
  • Synonyms
  • ORF length
    1617
  • Annotation
    This variant (delta) represents the longer transcript and encodes the longer isoform (delta).
  • siRNA

    GCUAUGAUGACAACUGGUAtt

    CGCUGAGCAGGUCAUCUUUtt

    GGCUAUGACUGGAGCACGAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-SP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6058
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"