Cart 2
  • Pparg Mouse  cDNA/ORF Clone

Pparg Mouse cDNA/ORF Clone

Cat.#: 709420-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 257.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    peroxisome proliferator activated receptor gamma
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Pparg
  • Gene Type
    protein coding
  • Also Known as
    Nr1c3; PPARgamma; PPAR-gamma; PPARgamma2; PPAR-gamma2
  • Encoded Protein Alias
    peroxisome proliferator-activated receptor gamma; nuclear receptor subfamily 1 group C member 3; peroxisome proliferator activated receptor gamma 2; peroxisome proliferator activated receptor gamma 4
  • Product Name
    Pparg(NM_011146) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1518
  • Annotation
    This variant (2) encodes the longer isoform (2).
  • siRNA

    GAUUGAAGCUUAUUUAUGAtt

    GCAUCUCCACCUUAUUAUUtt

    CUACGACAUGAAUUCCUUAtt

    GGGCGAUCUUGACAGGAAAtt

    CCAUCCGAUUGAAGCUUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-C-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6016
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"