Cart 2
  • Pparg Rat  cDNA/ORF Clone

Pparg Rat cDNA/ORF Clone

Cat.#: 708020-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    peroxisome proliferator-activated receptor gamma
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Pparg
  • Gene Type
    protein coding
  • Encoded Protein Alias
    peroxisome proliferator-activated receptor gamma; PPAR-gamma; nuclear receptor subfamily 1 group C member 3; peroxisome proliferator activated receptor gamma; peroxisome proliferator activator receptor, gamma
  • Product Name
    Pparg(NM_001145367) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus peroxisome proliferator-activated receptor gamma (Pparg), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1428
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. Both variants 2 and 3 encode the same protein.
  • siRNA

    CUACGACAUGAAUUCCUUAtt

    GGGCGAUCUUGACAGGAAAtt

    CCAUCCGAUUGAAGCUUAUtt

    GAUUGAAGCUUAUUUAUGAtt

    GCUCCACACUAUGAAGACAtt

    GAUUGAAGCUUAUUUAUGAtt

    GCUCCACACUAUGAAGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Pparg(NM_013124) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus peroxisome proliferator-activated receptor gamma (Pparg), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1518
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    CUACGACAUGAAUUCCUUAtt

    GGGCGAUCUUGACAGGAAAtt

    CCAUCCGAUUGAAGCUUAUtt

    GAUUGAAGCUUAUUUAUGAtt

    GCUCCACACUAUGAAGACAtt

    GAUUGAAGCUUAUUUAUGAtt

    GCUCCACACUAUGAAGACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"