NovoPro
Cart 2
  • PDZK1 Pongo abelii  cDNA/ORF Clones

PDZK1 Pongo abelii cDNA/ORF Clones

Cat.#: 719383-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    PDZ domain containing 1
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    PDZK1
  • Gene Type
    protein coding
  • Also Known as
    NHERF3
  • Encoded Protein Alias
    NHERF-3; Na(+)/H(+) exchanger regulatory factor 3; PDZ domain-containing protein 1; sodium-hydrogen exchanger regulatory factor 3
  • Product Name
    PDZK1(NM_001132834) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii PDZ domain containing 1 (PDZK1), mRNA.
  • Synonyms
  • ORF length
    1560
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"