NovoPro
Cart 2
  • PDZK1 Human  cDNA/ORF Clones

PDZK1 Human cDNA/ORF Clones

Cat.#: 712523-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 275.4 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    PDZ domain containing 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PDZK1
  • Gene Type
    protein coding
  • Also Known as
    CAP70; CLAMP; PDZD1; NHERF3; NHERF-3
  • Encoded Protein Alias
    Na(+)/H(+) exchange regulatory cofactor NHE-RF3; CFTR-associated protein of 70 kDa; PDZ-containing kidney protein 1; na/Pi cotransporter C-terminal-associated protein 1; naPi-Cap1; sodium-hydrogen exchanger regulatory factor 3
  • Product Name
    PDZK1(XM_017001466) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1230
  • siRNA

    GGCUAUGGUUUCUAUCUGAtt

    GGGUGGAGAUCAGACUUCAtt

    CAAGCUAAGAAAAUCCCUAtt

    GUCCACCAGAUACUACAGAtt

  • DataSheet:
  • Product Name
    PDZK1(XM_011509618) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1527
  • siRNA

    GGCUAUGGUUUCUAUCUGAtt

    GGGUGGAGAUCAGACUUCAtt

    CAAGCUAAGAAAAUCCCUAtt

    GUCCACCAGAUACUACAGAtt

  • DataSheet:
  • Product Name
    PDZK1(XM_017001467) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    939
  • siRNA

    GGCUAUGGUUUCUAUCUGAtt

    GGGUGGAGAUCAGACUUCAtt

    CAAGCUAAGAAAAUCCCUAtt

    GUCCACCAGAUACUACAGAtt

  • DataSheet:
  • Product Name
    PDZK1(NM_001201326) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1227
  • Annotation
    This variant (3) differs in the 5' UTR and lacks two exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    GGGUGGAGAUCAGACUUCAtt

    CAAGCUAAGAAAAUCCCUAtt

    GUCCACCAGAUACUACAGAtt

  • DataSheet:
  • Product Name
    PDZK1(XM_011509616) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1539
  • siRNA

    GGCUAUGGUUUCUAUCUGAtt

    GGGUGGAGAUCAGACUUCAtt

    CAAGCUAAGAAAAUCCCUAtt

    GUCCACCAGAUACUACAGAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"