NovoPro
Cart 2
  • PALLD Human  cDNA/ORF Clones

PALLD Human cDNA/ORF Clones

Cat.#: 708920-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,057.7 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    palladin, cytoskeletal associated protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    PALLD
  • Gene Type
    protein coding
  • Also Known as
    MYN; PNCA1; CGI151; SIH002; CGI-151
  • Encoded Protein Alias
    palladin; myoneurin; sarcoma antigen NY-SAR-77
  • Product Name
    PALLD(XM_011531768) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4407
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531773) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3735
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531774) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    3684
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531770) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4248
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_017007910) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4197
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(NM_001166109) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2334
  • Annotation
    This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream translational start codon, lacks an alternate in-frame exon in the central coding region, and lacks an exon in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531771) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4134
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531772) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    4035
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_011531769) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4356
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_005262866) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    3057
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(XM_017007911) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    2187
  • siRNA

    GCACCCUAGUUAUCGCUGAtt

  • DataSheet:
  • Product Name
    PALLD(XM_005262861) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    4203
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(NM_001166110) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2019
  • Annotation
    This variant (4) differs in the 5' UTR, lacks several exons in the 5' coding region, uses an alternate translational start codon, lacks an alternate in-frame exon in the central coding region, and lacks an exon in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has distinct N- and C-termini, compared to isoform 1.
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(NM_016081) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3321
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Product Name
    PALLD(NM_001166108) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3372
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GGGACAGUGGAGACGAAAAtt

    GCACCCUAGUUAUCGCUGAtt

    CAGUUGUACUGGACGGCUAtt

  • DataSheet:
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"