NovoPro
Cart 2
  • NCOA4 Human  cDNA/ORF Clone

NCOA4 Human cDNA/ORF Clone

Cat.#: 711672-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    nuclear receptor coactivator 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NCOA4
  • Gene Type
    protein coding
  • Also Known as
    RFG; ELE1; PTC3; ARA70
  • Encoded Protein Alias
    nuclear receptor coactivator 4; 70 kDa AR-activator; 70 kDa androgen receptor coactivator; NCoA-4; RET-activating gene ELE1; androgen receptor-associated protein of 70 kDa; ret fused
  • Product Name
    NCOA4(NM_005437) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens nuclear receptor coactivator 4 (NCOA4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1845
  • Annotation
    This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG. This variant (3) also lacks an exon in the 3' coding region, which results in a frameshift and use of a downstream stop codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus and a shorter, distinct C-terminus compared to isoform 1. Variants 3, 4, and 5 encode the same protein.
  • siRNA

    GGAAGUAUUACUUAAUUCAtt

    GGACCUUAUUUAUCAGCUUtt

    CAAUUGUCUUACUCAUCAAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    NCOA4(NM_001145260) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens nuclear receptor coactivator 4 (NCOA4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1953
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GGAAGUAUUACUUAAUUCAtt

    GGACCUUAUUUAUCAGCUUtt

    CAAUUGUCUUACUCAUCAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    NCOA4(NM_001145261) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens nuclear receptor coactivator 4 (NCOA4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1893
  • Annotation
    This variant (2) lacks an exon in the coding region, which results in a frameshift and use of a downstream stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.
  • siRNA

    GGAAGUAUUACUUAAUUCAtt

    GGACCUUAUUUAUCAGCUUtt

    CAAUUGUCUUACUCAUCAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"