Cart 2
  • nt5c3a Zebrafish  cDNA/ORF Clone

nt5c3a Zebrafish cDNA/ORF Clone

Cat.#: 737203-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 165.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    5'-nucleotidase, cytosolic IIIA
  • Organism
    Zebrafish
  • Entrez Gene ID
  • Gene Symbol
    nt5c3a
  • Gene Type
    protein coding
  • Also Known as
    nt5c3; fb30h07; zgc:66117; wu:fb30h07
  • Encoded Protein Alias
    5'-nucleotidase, cytosolic III; cN-III; cytosolic 5'-nucleotidase III
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"