NovoPro
Cart 2
  • NPRL2 Ferret  cDNA/ORF Clones

NPRL2 Ferret cDNA/ORF Clones

Cat.#: 700002-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    NPR2-like, GATOR1 complex subunit
  • Organism
    Ferret
  • Entrez Gene ID
  • Gene Symbol
    NPRL2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    nitrogen permease regulator-like 2 (S. cerevisiae)
  • Product Name
    NPRL2(XM_004760562) Ferret cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mustela putorius furo nitrogen permease regulator-like 2 (S. cerevisiae) (NPRL2), mRNA.
  • Synonyms
  • ORF length
    1143
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"