NovoPro
Cart 2
  • Nlgn1 Mouse  cDNA/ORF Clones

Nlgn1 Mouse cDNA/ORF Clones

Cat.#: 702593-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 486.0 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    neuroligin 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Nlgn1
  • Gene Type
    protein coding
  • Also Known as
    NL1; Nlg1; BB179718; mKIAA1070; 6330415N05Rik
  • Encoded Protein Alias
    neuroligin-1
  • Product Name
    Nlgn1(NM_001163387) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus neuroligin 1 (Nlgn1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2445
  • Annotation
    This variant (2) differs in the 5' UTR and lacks two alternate in-frame segments compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    CAGUAUACCUCGACAACAAtt

    GGGUUGAAGUUUGUCGAAAtt

    GGAUGAUCCCAAGCAACAAtt

  • DataSheet:
  • Product Name
    Nlgn1(XM_006535423) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus neuroligin 1 (Nlgn1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    2505
  • siRNA
  • DataSheet:
  • Product Name
    Nlgn1(XM_006535421) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus neuroligin 1 (Nlgn1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2565
  • siRNA
  • DataSheet:
  • Product Name
    Nlgn1(NM_138666) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus neuroligin 1 (Nlgn1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2532
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CAGUAUACCUCGACAACAAtt

    GGGUUGAAGUUUGUCGAAAtt

    GGAUGAUCCCAAGCAACAAtt

  • DataSheet:
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"