NovoPro
Cart 2
  • NRXN1 Human  cDNA/ORF Clones

NRXN1 Human cDNA/ORF Clones

Cat.#: 711055-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,059.8 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    neurexin 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    NRXN1
  • Gene Type
    protein coding
  • Also Known as
    PTHSL2; SCZD17; Hs.22998
  • Encoded Protein Alias
    neurexin-1-beta; neurexin I
  • Product Name
    NRXN1(XM_017005326) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X34, mRNA.
  • Synonyms
  • ORF length
    4416
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001330081) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    837
  • Annotation
    This variant (7) lacks multiple 3' coding exons and contains an alternate 3' terminal exon compared to variant alpha2. The encoded isoform (7) is much shorter than isoform alpha2.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(XM_011533180) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X39, mRNA.
  • Synonyms
  • ORF length
    4353
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_011533177) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X29, mRNA.
  • Synonyms
  • ORF length
    4455
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005308) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4551
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005334) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X45, mRNA.
  • Synonyms
  • ORF length
    3612
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005327) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X35, mRNA.
  • Synonyms
  • ORF length
    4401
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_138735) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant beta1, mRNA.
  • Synonyms
  • ORF length
    1329
  • Annotation
    This variant (beta1) results from the use of an alternate promoter, referred to as beta. It contains an alternate 5' terminal exon and lacks most of the 5' exons and another exon in the 3' region compared to variant alpha2. The resulting isoform (beta1) is shorter with a distinct N-terminus lacking the EGF-like domain and containing fewer laminin G domains compared to isoform alpha2.
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005314) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    4512
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005305) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4563
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005316) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    4509
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005307) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4554
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005321) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X26, mRNA.
  • Synonyms
  • ORF length
    4482
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001135659) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant alpha2, mRNA.
  • Synonyms
  • ORF length
    4644
  • Annotation
    This variant (alpha2) results from the use of the 5'-most promoter, referred to as alpha. It represents the longest transcript that encodes the longest isoform (alpha2) of the representative RefSeq variants. This isoform contains EGF-like, several laminin G, and syndecan domains.
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001330089) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    855
  • Annotation
    This variant (8) lacks multiple 3' coding exons and contains an alternate 3' exon structure compared to variant alpha2. The encoded isoform (8) is much shorter than isoform alpha2 and has a distinct C-terminus.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(XM_017005306) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    4560
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_006712137) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X31, mRNA.
  • Synonyms
  • ORF length
    4446
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005309) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    4545
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005310) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    4542
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_004801) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant alpha1, mRNA.
  • Synonyms
  • ORF length
    4434
  • Annotation
    This variant (alpha1) results from the use of the 5'-most promoter, referred to as alpha. It lacks two in-frame exons and uses an alternate in-frame donor splice site at an internal exon compared to variant alpha2. The resulting isoform (alpha1) is shorter missing a few internal protein segments compared to isoform alpha2. This isoform contains EGF-like, several laminin G, and syndecan domains.
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005303) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4572
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005311) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    4527
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005325) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X33, mRNA.
  • Synonyms
  • ORF length
    4419
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005315) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    4509
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_006712140) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X43, mRNA.
  • Synonyms
  • ORF length
    4278
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_011533183) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X44, mRNA.
  • Synonyms
  • ORF length
    3678
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001320156) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant gamma1, mRNA.
  • Synonyms
  • ORF length
    429
  • Annotation
    This variant (gamma1) results from the use of an alternate promoter, referred to as gamma. It contains an alternate 5' terminal exon and lacks all the exons, except the last two 3' terminal exons, compared to variant alpha2. Hence, the encoded isoform (gamma1) is considerably shorter with a distinct N-terminus lacking the EGF-like and laminin G domains, and containing only the syndecan domain compared to isoform alpha2.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(XM_017005304) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4569
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001330079) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    834
  • Annotation
    This variant (6) lacks multiple 3' coding exons and contains an alternate 3' terminal exon compared to variant alpha2. The encoded isoform (6) is much shorter than isoform alpha2.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(XM_011533167) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    4545
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005324) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    4428
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005318) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    4500
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005320) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    4488
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005322) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X27, mRNA.
  • Synonyms
  • ORF length
    4473
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_017005329) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X37, mRNA.
  • Synonyms
  • ORF length
    4380
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_005264642) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    4536
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(NM_001330090) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    909
  • Annotation
    This variant (9) lacks multiple 3' coding exons and contains an alternate 3' terminal exon compared to variant alpha2. The encoded isoform (9) is much shorter than isoform alpha2 and has a distinct C-terminus.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(NM_001320157) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens neurexin 1 (NRXN1), transcript variant gamma2, mRNA.
  • Synonyms
  • ORF length
    420
  • Annotation
    This variant (gamma2) results from the use of an alternate promoter, referred to as gamma. It contains an alternate 5' terminal exon and lacks all the exons, except the last two 3' terminal exons (the penultimate exon uses an alternate in-frame donor splice site), compared to variant alpha2. Hence, the encoded isoform (gamma2) is considerably shorter with a distinct N-terminus lacking the EGF-like and laminin G domains, and containing only the syndecan domain compared to isoform alpha2.
  • siRNA
  • DataSheet:
  • Product Name
    NRXN1(XM_011533178) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X30, mRNA.
  • Synonyms
  • ORF length
    4455
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_011533175) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X24, mRNA.
  • Synonyms
  • ORF length
    4488
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Product Name
    NRXN1(XM_011533172) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens neurexin 1 (NRXN1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    4518
  • siRNA

    GGGACGACAUAUAUCUUUAtt

    CGACAUAUAUCUUUAGCAAtt

    CCAAUGCAAUCAUUAAUGAtt

    CUUCCUCUAUGACAACUGAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"