NovoPro
Cart 2
  • NDRG2 Pongo abelii  cDNA/ORF Clones

NDRG2 Pongo abelii cDNA/ORF Clones

Cat.#: 720107-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 185.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    NDRG family member 2
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    NDRG2
  • Gene Type
    protein coding
  • Also Known as
    DKFZP470K0227
  • Product Name
    NDRG2(XM_009248843) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii NDRG family member 2 (NDRG2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1083
  • DataSheet:
  • Product Name
    NDRG2(XM_009248851) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii NDRG family member 2 (NDRG2), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    960
  • DataSheet:
  • Product Name
    NDRG2(XM_009248850) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii NDRG family member 2 (NDRG2), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1026
  • DataSheet:
  • Product Name
    NDRG2(NM_001135315) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii NDRG family member 2 (NDRG2), mRNA.
  • Synonyms
  • ORF length
    1116
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"