NovoPro
Cart 2
  • MYLPF Human  cDNA/ORF Clones

MYLPF Human cDNA/ORF Clones

Cat.#: 707639-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    myosin light chain, phosphorylatable, fast skeletal muscle
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MYLPF
  • Gene Type
    protein coding
  • Also Known as
    MLC2B; MRLC2; MYL11; HUMMLC2B
  • Encoded Protein Alias
    myosin regulatory light chain 2, skeletal muscle isoform; MLC2B; MYLPF; fast skeletal myosin light chain 2; myosin light chain 2; myosin, light chain 11, regulatory
  • Product Name
    MYLPF(NM_013292) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens myosin light chain, phosphorylatable, fast skeletal muscle (MYLPF), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    510
  • Annotation
    This variant (2) and variants 1 and 3 all encode the same protein.
  • siRNA

    GCAACGUCGACUACAAAAAtt

    GAACCGUGAUGGUAUUAUAtt

    CCUUCACUGUGAUCGACCAtt

    CCAAUAAAAUUUAACUGAUtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"