NovoPro
Cart 2
  • Myc Mouse  cDNA/ORF Clones

Myc Mouse cDNA/ORF Clones

Cat.#: 709034-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 255.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    myelocytomatosis oncogene
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Myc
  • Gene Type
    protein coding
  • Also Known as
    Myc2; Nird; Niard; bHLHe39; AU016757
  • Encoded Protein Alias
    myc proto-oncogene protein; c-myc proto-oncogene; transcription factor p64
  • Product Name
    Myc(NM_001177353) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus myelocytomatosis oncogene (Myc), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1362
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This variant encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (c) is derived from a non-AUG (CUG) start codon, while a shorter isoform (b, also known as c-Myc 2) is derived from a downstream AUG start codon. The longer isoform (c) is represented in this RefSeq, and is 1 aa shorter, compared to isoform a.
  • siRNA

    AGGUAGUGAUCCUCAAAAAtt

    AGCUCACCUCUGAAAAGGAtt

    CCAGAUCCCUGAAUUGGAAtt

  • DataSheet:
  • Product Name
    Myc(NM_001177352) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus myelocytomatosis oncogene (Myc), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1320
  • Annotation
    This variant (1) represents the longer transcript and encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (a, also known as c-Myc 1) is derived from a non-AUG (CUG) start codon, while a shorter isoform (b, also known as c-Myc 2) is derived from a downstream AUG start codon. The shorter isoform (b) is represented in this RefSeq, and is 15 aa shorter, compared to isoform a. Both variants 1 and 2 can encode isoform b.
  • siRNA

    AGGUAGUGAUCCUCAAAAAtt

    AGCUCACCUCUGAAAAGGAtt

    CCAGAUCCCUGAAUUGGAAtt

  • DataSheet:
  • Product Name
    Myc(NM_010849) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus myelocytomatosis oncogene (Myc), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1365
  • Annotation
    This variant (1) represents the longer transcript and encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (a, also known as c-Myc 1) is derived from a non-AUG (CUG) start codon, while a shorter isoform (b, also known as c-Myc 2) is derived from a downstream AUG start codon. The longer isoform (a) is represented in this RefSeq.
  • siRNA

    AGGUAGUGAUCCUCAAAAAtt

    AGCUCACCUCUGAAAAGGAtt

    CCAGAUCCCUGAAUUGGAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"