NovoPro
Cart 2
  • Mtch2 Mouse  cDNA/ORF Clones

Mtch2 Mouse cDNA/ORF Clones

Cat.#: 745133-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 160.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitochondrial carrier 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Mtch2
  • Gene Type
    protein coding
  • Also Known as
    HSPC032; 2310034D24Rik; 4930539J07Rik
  • Encoded Protein Alias
    Mitochondrial carrier homolog 2
  • Product Name
    Mtch2(NM_001317242) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    939
  • Annotation
    This variant (2) uses an alternate in-frame acceptor splice site at an internal coding exon compared to variant 1. The resulting isoform (2) is longer containing a 9 aa protein segment not found in isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    Mtch2(NM_001317241) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    945
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1054-1056), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1087-1089). This RefSeq represents the longer, C-terminally extended isoform. As the UGA stop codon has been reported to specify several alternative amino acids (tryptophan, cysteine, arginine and serine), its location in the longer isoform is denoted by an 'X'.
  • siRNA
  • DataSheet:
  • Product Name
    Mtch2(NM_001317244) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    531
  • Annotation
    This variant (4) uses an alternate acceptor splice site at an internal exon, which results in translation initiation from an in-frame, downstream start codon compared to variant 1. The encoded isoform (4) has a shorter N-terminus compared to isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    Mtch2(NM_001317243) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    885
  • Annotation
    This variant (3) lacks an in-frame coding exon compared to variant 1. The resulting isoform (3) is shorter missing an internal 9 aa protein segment compared to isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    Mtch2(NM_019758) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus mitochondrial carrier 2 (Mtch2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    912
  • Annotation
    This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1054-1056), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon (nt 1087-1089). This RefSeq represents the shorter isoform.
  • siRNA

    CAACAAUAGGACGAAAUAUtt

    CCUCCUAGGUGACAUCAUUtt

    CUUUGACCGAGUUAUCAAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"