NovoPro
Cart 2
  • MSANTD3-TMEFF1 Human  cDNA/ORF Clones

MSANTD3-TMEFF1 Human cDNA/ORF Clones

Cat.#: 717593-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 191.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    MSANTD3-TMEFF1 readthrough
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MSANTD3-TMEFF1
  • Gene Type
    protein coding
  • Also Known as
    C9orf3-TMEFF1; C9orf30-TMEFF1
  • Product Name
    MSANTD3-TMEFF1(NM_001198812) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens MSANTD3-TMEFF1 readthrough (MSANTD3-TMEFF1), mRNA.
  • Synonyms
  • ORF length
    1365
  • siRNA

    CUCUGAUAAUGGAUCUGGAtt

    GCUCACUCAUGUUCUUAUUtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"