NovoPro
Cart 2
  • Tfdp2 Mouse  cDNA/ORF Clones

Tfdp2 Mouse cDNA/ORF Clones

Cat.#: 766946-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 221.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transcription factor Dp 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Tfdp2
  • Gene Type
    protein coding
  • Also Known as
    DP3; DP-3; 1110029I05Rik; A330080J22Rik
  • Product Name
    Tfdp2(XM_006510964) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1293
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510978) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1113
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510961) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1344
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510963) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1296
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510980) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    1005
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(NM_001184711) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1161
  • Annotation
    This variant (6) represents use of an alternate promoter, differs in the 5' UTR, and uses an alternate in-frame splice site in the coding region, compared to variant 1. The resulting isoform (D) includes an extra one amino acid segment, compared to isoform A.
  • siRNA

    GAAGUGUUCUGAUUGGGAAtt

    GGGACUACUUUUGAACUCUtt

    GAAGAACAUUAGACGAAGAtt

  • DataSheet:
  • Product Name
    Tfdp2(XM_017313267) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    1110
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(NM_001184708) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    933
  • Annotation
    This variant (4) lacks several alternate exon and uses a downstream start codon, compared to variant 1. The resulting isoform (B) has a shorter N-terminus, compared to isoform A.
  • siRNA

    GGGACUACUUUUGAACUCUtt

    GAAGAACAUUAGACGAAGAtt

  • DataSheet:
  • Product Name
    Tfdp2(XM_017313266) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1197
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510962) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1341
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(NM_001184710) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1080
  • Annotation
    This variant (5) represents use of an alternate promoter, differs in the 5' UTR, lacks an alternate exon, and uses a downstream start codon, compared to variant 1. The resulting isoform (C) has a shorter N-terminus, compared to isoform A.
  • siRNA

    GAAGUGUUCUGAUUGGGAAtt

    GGGACUACUUUUGAACUCUtt

    GAAGAACAUUAGACGAAGAtt

  • DataSheet:
  • Product Name
    Tfdp2(XM_006510966) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1290
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510968) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1242
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(XM_006510967) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1245
  • siRNA
  • DataSheet:
  • Product Name
    Tfdp2(NM_178667) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1158
  • Annotation
    This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (A).
  • siRNA

    GAAGUGUUCUGAUUGGGAAtt

    GGGACUACUUUUGAACUCUtt

    GAAGAACAUUAGACGAAGAtt

  • DataSheet:
  • Product Name
    Tfdp2(XM_006510965) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1293
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"