NovoPro
Cart 2
  • Tcof1 Mouse  cDNA/ORF Clone

Tcof1 Mouse cDNA/ORF Clone

Cat.#: 767930-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 942.5 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    treacle ribosome biogenesis factor 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Tcof1
  • Gene Type
    protein coding
  • Also Known as
    treacle; AA408847; AW209012
  • Product Name
    Tcof1(NM_001198984) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus treacle ribosome biogenesis factor 1 (Tcof1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4071
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GGGUCCAAAUGGUAAAGAAtt

    CCCUAAAACCGGUAGGAAAtt

    AGAGCAAGUCGAAAAAGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Tcof1(NM_011552) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus treacle ribosome biogenesis factor 1 (Tcof1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3963
  • Annotation
    This variant (2) lacks an in-frame alternate exon in the 3' coding region, compared to variant 1, and encodes a shorter isoform (2), compared to isoform 1.
  • siRNA

    GGGUCCAAAUGGUAAAGAAtt

    CCCUAAAACCGGUAGGAAAtt

    AGAGCAAGUCGAAAAAGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"