Cart 2
  • Slc25a23 Mouse  cDNA/ORF Clone

Slc25a23 Mouse cDNA/ORF Clone

Cat.#: 769723-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 221.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Slc25a23
  • Gene Type
    protein coding
  • Also Known as
    SCaMC-3; 2310067G05Rik
  • Encoded Protein Alias
    solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
  • Product Name
    Slc25a23(NM_025877) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 (Slc25a23), mRNA.
  • Synonyms
  • ORF length
    1404
  • siRNA

    AGCGGAUCUUAGAACGUGAtt

    GCCUGUUCGAGGAACUAGAtt

    GAACCAAGAUGGUCACAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"