Cart 2
  • Rps6ka1 Mouse  cDNA/ORF Clone

Rps6ka1 Mouse cDNA/ORF Clone

Cat.#: 756102-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 370.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ribosomal protein S6 kinase polypeptide 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Rps6ka1
  • Gene Type
    protein coding
  • Also Known as
    Rsk; Rsk1; Rsk-1; p90S6K; p90rsk; p90Rsk1; p90-Rsk1; Mapkapk-1a; S6K-alpha-1
  • Product Name
    Rps6ka1(NM_001285506) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ribosomal protein S6 kinase polypeptide 1 (Rps6ka1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2160
  • Annotation
    This variant (3) contains alternate 5' exon structure and it thus differs in the 5' UTR and 5' coding region, and it initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a.
  • siRNA

    GGUCAUCGACAAGAGCAAAtt

    AGGAGGUCAUGUUUACAGAtt

    AGACAUAUCUUCUACUCCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Rps6ka1(NM_009097) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ribosomal protein S6 kinase polypeptide 1 (Rps6ka1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2208
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    GGUCAUCGACAAGAGCAAAtt

    AGGAGGUCAUGUUUACAGAtt

    AGACAUAUCUUCUACUCCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Rps6ka1(NM_001285505) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ribosomal protein S6 kinase polypeptide 1 (Rps6ka1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2175
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.
  • siRNA

    GGUCAUCGACAAGAGCAAAtt

    AGGAGGUCAUGUUUACAGAtt

    AGACAUAUCUUCUACUCCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"