NovoPro
Cart 2
  • Rapgef4 Mouse  cDNA/ORF Clones

Rapgef4 Mouse cDNA/ORF Clones

Cat.#: 767627-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 437.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Rap guanine nucleotide exchange factor (GEF) 4
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Rapgef4
  • Gene Type
    protein coding
  • Also Known as
    Epac2; EPAC 2; Epac-2; mKIAA4040; 1300003D15Rik; 5730402K07Rik; 6330581N18Rik
  • Product Name
    Rapgef4(XM_017319138) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2550
  • siRNA
  • DataSheet:
  • Product Name
    Rapgef4(XM_017319139) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2523
  • siRNA
  • DataSheet:
  • Product Name
    Rapgef4(NM_001204165) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3036
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GGAACAGAGCUGCUAAUCAtt

    GGAAGACUUCAAUCGGAUUtt

    GGCAAUUAAAUGUGAUUGAtt

  • DataSheet:
  • Product Name
    Rapgef4(NM_001204167) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    729
  • Annotation
    This variant (4) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    Rapgef4(XM_006499938) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2376
  • siRNA
  • DataSheet:
  • Product Name
    Rapgef4(NM_019688) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2982
  • Annotation
    This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    GGAACAGAGCUGCUAAUCAtt

    GGAAGACUUCAAUCGGAUUtt

    GGCAAUUAAAUGUGAUUGAtt

  • DataSheet:
  • Product Name
    Rapgef4(NM_001204166) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2604
  • Annotation
    This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon in an alternate exon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
  • siRNA

    GGAACAGAGCUGCUAAUCAtt

    GGAAGACUUCAAUCGGAUUtt

    GGCAAUUAAAUGUGAUUGAtt

  • DataSheet:
  • Product Name
    Rapgef4(XM_011239711) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2520
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"