Cart 2
  • Ranbp2 Mouse  cDNA/ORF Clone

Ranbp2 Mouse cDNA/ORF Clone

Cat.#: 751335-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 1,616.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    RAN binding protein 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ranbp2
  • Gene Type
    protein coding
  • Also Known as
    NUP358; AI256741; A430087B05Rik
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"