NovoPro
Cart 2
  • Prss36 Mouse  cDNA/ORF Clones

Prss36 Mouse cDNA/ORF Clones

Cat.#: 751229-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 343.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protease, serine 36
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Prss36
  • Gene Type
    protein coding
  • Also Known as
    C330007D15Rik
  • Product Name
    Prss36(XM_017312390) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1833
  • DataSheet:
  • Product Name
    Prss36(NM_001319147) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protease, serine 36 (Prss36), mRNA.
  • Synonyms
  • ORF length
    2559
  • DataSheet:
  • Product Name
    Prss36(XM_017312387) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1959
  • DataSheet:
  • Product Name
    Prss36(XM_017312389) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1839
  • DataSheet:
  • Product Name
    Prss36(XM_017312395) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    2592
  • DataSheet:
  • Product Name
    Prss36(XM_017312394) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1323
  • DataSheet:
  • Product Name
    Prss36(XM_017312392) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1431
  • DataSheet:
  • Product Name
    Prss36(XM_017312393) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1401
  • DataSheet:
  • Product Name
    Prss36(XM_017312391) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1551
  • DataSheet:
  • Product Name
    Prss36(XM_017312388) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protease, serine 36 (Prss36), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1884
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"