NovoPro
Cart 2
  • Prl3d1 Mouse  cDNA/ORF Clones

Prl3d1 Mouse cDNA/ORF Clones

Cat.#: 767745-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    prolactin family 3, subfamily d, member 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Prl3d1
  • Gene Type
    protein coding
  • Also Known as
    Pl1; Csh1; Ghd4; PL-I; Pl-1; PL-Ia; mPL-I; AI325057; PL-I-alpha
  • Product Name
    Prl3d1(NM_008864) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prolactin family 3, subfamily d, member 1 (Prl3d1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    672
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
  • siRNA

    GGAAGUCCACGAAACUAAAtt

    GGAAUUAUUGUCAUAAAAUtt

    CCUCAGUUAUGUAGAGCUAtt

  • DataSheet:
  • Product Name
    Prl3d1(NM_001205322) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus prolactin family 3, subfamily d, member 1 (Prl3d1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    675
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GGAAGUCCACGAAACUAAAtt

    GGAAUUAUUGUCAUAAAAUtt

    CCUCAGUUAUGUAGAGCUAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"