NovoPro
Cart 2
  • Ppfia1 Mouse  cDNA/ORF Clones

Ppfia1 Mouse cDNA/ORF Clones

Cat.#: 767743-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 887.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ppfia1
  • Gene Type
    protein coding
  • Also Known as
    LIP1; LIP.1; C87158; C030014K08Rik
  • Product Name
    Ppfia1(XM_017322222) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    3696
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_017322224) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    3648
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_011241997) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    1905
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_011241995) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    3789
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508605) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    3738
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508611) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    3573
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_017322221) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    3771
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_017322223) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    3684
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508607) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    3714
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(NM_001195086) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant A, mRNA.
  • Synonyms
  • ORF length
    3801
  • Annotation
    This variant (A) represents the longer transcript and encodes the longer isoform (A).
  • siRNA

    GGUCGUUUUAGAUCAAUGAtt

    GGACAAUCUUGGUCGUUUUtt

    GCAUGAUAAGGACCAACUUtt

    GGCUGAUACAAGAAGAGAAtt

    GCUAAUGAUUCUUAAAGAAtt

  • DataSheet:
  • Product Name
    Ppfia1(XM_006508599) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    3801
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_011241992) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3831
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(NM_001033319) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant B, mRNA.
  • Synonyms
  • ORF length
    3726
  • Annotation
    This variant (B) lacks an in-frame exon in the 5' coding region, compared to variant A. The resulting protein (isoform B) is shorter than isoform A.
  • siRNA

    GGUCGUUUUAGAUCAAUGAtt

    GGACAAUCUUGGUCGUUUUtt

    GCAUGAUAAGGACCAACUUtt

    GGCUGAUACAAGAAGAGAAtt

    GCUAAUGAUUCUUAAAGAAtt

  • DataSheet:
  • Product Name
    Ppfia1(XM_006508610) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    3606
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508608) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    3711
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_011241991) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3834
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508603) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    3741
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508598) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    3804
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_017322220) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    3771
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508609) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    3681
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508604) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    3741
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508601) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    3774
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_006508612) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    3699
  • siRNA
  • DataSheet:
  • Product Name
    Ppfia1(XM_011241996) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3864
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"