NovoPro
Cart 2
  • Papln Mouse  cDNA/ORF Clones

Papln Mouse cDNA/ORF Clones

Cat.#: 767726-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 922.3 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    papilin, proteoglycan-like sulfated glycoprotein
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Papln
  • Gene Type
    protein coding
  • Also Known as
    E030033C16Rik
  • Product Name
    Papln(NM_130887) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus papilin, proteoglycan-like sulfated glycoprotein (Papln), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3843
  • Annotation
    This variant (2) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    GGCAGGUUGUUUGUACCAUtt

    CCAUCUCCUCUAACAGGUAtt

    CAGUGAGUGUCGAAGCUCUtt

  • DataSheet:
  • Product Name
    Papln(NM_001205343) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus papilin, proteoglycan-like sulfated glycoprotein (Papln), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3909
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GGCAGGUUGUUUGUACCAUtt

    CCAUCUCCUCUAACAGGUAtt

    CAGUGAGUGUCGAAGCUCUtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"