NovoPro
Cart 2
  • Palld Mouse  cDNA/ORF Clones

Palld Mouse cDNA/ORF Clones

Cat.#: 751213-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 350.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    palladin, cytoskeletal associated protein
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Palld
  • Gene Type
    protein coding
  • Also Known as
    6030492A02; 2410003B16Rik
  • Product Name
    Palld(XM_006509508) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2043
  • siRNA
  • DataSheet:
  • Product Name
    Palld(XM_006509503) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    4176
  • siRNA
  • DataSheet:
  • Product Name
    Palld(NM_001293773) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3009
  • Annotation
    This variant (2) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1.
  • siRNA

    GAGCGAUCACUACACCAUUtt

    AGAACUCGUUUAACCUGGAtt

    ACAAGAUGCUGGUCCGUGAtt

  • DataSheet:
  • Product Name
    Palld(NM_001293772) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4227
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GAGCGAUCACUACACCAUUtt

    AGAACUCGUUUAACCUGGAtt

    ACAAGAUGCUGGUCCGUGAtt

  • DataSheet:
  • Product Name
    Palld(NM_001293774) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1992
  • Annotation
    This variant (3) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1.
  • siRNA

    GAGCGAUCACUACACCAUUtt

    AGAACUCGUUUAACCUGGAtt

    ACAAGAUGCUGGUCCGUGAtt

  • DataSheet:
  • Product Name
    Palld(NM_001081390) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant 4, mRNA.
  • Synonyms
    XM_974829  
  • ORF length
    3342
  • Annotation
    This variant (4) lacks two alternate in-frame exons and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (4) lacks two alternate internal segments and has a shorter and distinct C-terminus compared to isoform 1.
  • siRNA

    GAGCGAUCACUACACCAUUtt

    AGAACUCGUUUAACCUGGAtt

    ACAAGAUGCUGGUCCGUGAtt

  • DataSheet:
  • Product Name
    Palld(XM_006509504) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus palladin, cytoskeletal associated protein (Palld), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    3060
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"