NovoPro
Cart 2
  • Oprk1 Mouse  cDNA/ORF Clones

Oprk1 Mouse cDNA/ORF Clones

Cat.#: 767671-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 210.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    opioid receptor, kappa 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Oprk1
  • Gene Type
    protein coding
  • Also Known as
    KOR; R21; KOR-1; MSL-1; Oprk2; K-OR-1
  • Product Name
    Oprk1(NM_001318735) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus opioid receptor, kappa 1 (Oprk1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1230
  • Annotation
    This variant (1) represents the longer transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1356-1358), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UGA termination codon (nt 1443-1445). This RefSeq represents the longer, C-terminally extended isoform. As the UGA stop codon has been reported to specify several alternative amino acids (tryptophan, cysteine, arginine and serine), the location of the upstream UGA stop codon in the longer isoform is denoted by an 'X'.
  • siRNA
  • DataSheet:
  • Product Name
    Oprk1(NM_011011) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus opioid receptor, kappa 1 (Oprk1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1143
  • Annotation
    This variant (1) represents the longer transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon (nt 1356-1358), while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UGA termination codon (nt 1443-1445). This RefSeq represents the shorter isoform. Variants 1 and 2 encode the same isoform.
  • siRNA

    UGUUUGUCAUCAUCCGAUAtt

    GCAAGAUUGUCAUUUCCAUtt

    GCACCAAUAGAGUUAGAAAtt

  • DataSheet:
  • Product Name
    Oprk1(XM_006495470) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus opioid receptor, kappa 1 (Oprk1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    876
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"