NovoPro
Cart 2
  • Jag1 Mouse  cDNA/ORF Clones

Jag1 Mouse cDNA/ORF Clones

Cat.#: 752035-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 763.2 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    jagged 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Jag1
  • Gene Type
    protein coding
  • Also Known as
    Htu; Ozz; ABE2; Ser-1; Gsfabe2
  • Product Name
    Jag1(XM_011239312) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus jagged 1 (Jag1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3180
  • siRNA
  • DataSheet:
  • Product Name
    Jag1(NM_013822) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus jagged 1 (Jag1), mRNA.
  • Synonyms
    XM_990538  
  • ORF length
    3657
  • siRNA

    GCAGGAUAAACAUCAAUGAtt

    CGAGAACAAAAACUCGAAAtt

    GGAGACAACUGGUAUCGGUtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"