NovoPro
Cart 2
  • Grin3a Mouse  cDNA/ORF Clone

Grin3a Mouse cDNA/ORF Clone

Cat.#: 767907-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 475.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    glutamate receptor ionotropic, NMDA3A
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Grin3a
  • Gene Type
    protein coding
  • Also Known as
    NR3A; NMDAR-L; mKIAA1973; 6430537F04; A830097C19Rik
  • Product Name
    Grin3a(NM_001033351) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus glutamate receptor ionotropic, NMDA3A (Grin3a), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3348
  • Annotation
    This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
  • siRNA

    GCACCUACAGCUGAGUUUAtt

    CCACCAAUGGGAAAGCAGAtt

    CCAAACAAGUUACACUUGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Grin3a(NM_001276355) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus glutamate receptor ionotropic, NMDA3A (Grin3a), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3408
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GCACCUACAGCUGAGUUUAtt

    CCACCAAUGGGAAAGCAGAtt

    CCAAACAAGUUACACUUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"