NovoPro
Cart 2
  • Gon4l Mouse  cDNA/ORF Clone

Gon4l Mouse cDNA/ORF Clone

Cat.#: 767905-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    gon-4-like (C.elegans)
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Gon4l
  • Gene Type
    protein coding
  • Also Known as
    AA387005; 1500041I23Rik; 2610100B20Rik; 3632445O20Rik; 5430404N14Rik
  • Product Name
    Gon4l(NM_001242372) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus gon-4-like (C.elegans) (Gon4l), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    6780
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    CAUGUGAACUUAGCAGUCUtt

    GGUUACCAGAGAAGACCGAtt

    GGGCUGUUGUCAAAACAGAtt

    CGAUCAGCACUUACAGAAAtt

    GGACGGUUGUGAAAACAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"