NovoPro
Cart 2
  • Zfp967 Mouse  cDNA/ORF Clones

Zfp967 Mouse cDNA/ORF Clones

Cat.#: 767874-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 273.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    zinc finger protein 967
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Zfp967
  • Gene Type
    protein coding
  • Also Known as
    Gm14431; OTTMUSG00000016608
  • Product Name
    Zfp967(NM_001177404) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus zinc finger protein 967 (Zfp967), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    417
  • Annotation
    This variant (2) lacks an internal exon in the 5' region and an internal segment in the 3' region, as compared to variant 1. The resulting isoform (2) is shorter; it has a different C-terminus and lacks zinc finger C2H2 type domain, as compared to isoform 1.
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"