NovoPro
Cart 2
  • Ctbp1 Mouse  cDNA/ORF Clones

Ctbp1 Mouse cDNA/ORF Clones

Cat.#: 767804-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 248.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    C-terminal binding protein 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ctbp1
  • Gene Type
    protein coding
  • Also Known as
    BARS; D4S115h; D5H4S115; D5H4S115E; CtBP3/BARS
  • Product Name
    Ctbp1(NM_001198859) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus C-terminal binding protein 1 (Ctbp1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1323
  • Annotation
    This variant (1) uses an alternate in-frame splice site in the 3' coding region compared to variant 3. It encodes a shorter isoform (1) compared to isoform 3.
  • siRNA

    CCUUAAAGGAUGCACCCAAtt

    CCAGAUAGCUUGAAAAACUtt

    AGAUAGCUUGAAAAACUGUtt

  • DataSheet:
  • Product Name
    Ctbp1(NM_001198861) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus C-terminal binding protein 1 (Ctbp1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1293
  • Annotation
    This variant (4) contains an alternate exon in the 5' region and initiates translation at an alternate start codon, compared to variant 3. It encodes a shorter isoform (4) with a distinct N-terminus compared to isoform 3.
  • siRNA

    CCUUAAAGGAUGCACCCAAtt

    CCAGAUAGCUUGAAAAACUtt

    AGAUAGCUUGAAAAACUGUtt

  • DataSheet:
  • Product Name
    Ctbp1(NM_001198860) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus C-terminal binding protein 1 (Ctbp1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1290
  • Annotation
    This variant (2) contains an alternate exon in the 5' region, initiates translation at an alternate start codon, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 3. It encodes a shorter isoform (2) with a distinct N-terminus compared to isoform 3.
  • siRNA

    CCUUAAAGGAUGCACCCAAtt

    CCAGAUAGCUUGAAAAACUtt

    AGAUAGCUUGAAAAACUGUtt

  • DataSheet:
  • Product Name
    Ctbp1(NM_001310535) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus C-terminal binding protein 1 (Ctbp1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1104
  • Annotation
    This variant (5) lacks an alternate exon in the 5' region and initiates translation at a downstream start codon, compared to variant 3. It encodes a shorter isoform (5) with a shorter N-terminus compared to isoform 3.
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"