NovoPro
Cart 2
  • Cngb1 Mouse  cDNA/ORF Clones

Cngb1 Mouse cDNA/ORF Clones

Cat.#: 767795-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 954.7 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclic nucleotide gated channel beta 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cngb1
  • Gene Type
    protein coding
  • Also Known as
    Cngb1b; Gm1959
  • Product Name
    Cngb1(NM_001195413) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3978
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GCACAGAUCCCAGAACCUUtt

  • DataSheet:
  • Product Name
    Cngb1(NM_145601) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    981
  • Annotation
    This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct C-terminus and is shorter than isoform 1.
  • siRNA

    GCACAGAUCCCAGAACCUUtt

    CCAGAGUCAUUAAGUGUAAtt

    ACAUUGUAAUUGACAUUAAtt

  • DataSheet:
  • Product Name
    Cngb1(XM_006531140) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus cyclic nucleotide gated channel beta 1 (Cngb1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2601
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"