NovoPro
Cart 2
  • Cnga3 Mouse  cDNA/ORF Clones

Cnga3 Mouse cDNA/ORF Clones

Cat.#: 767793-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 376.9 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclic nucleotide gated channel alpha 3
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cnga3
  • Gene Type
    protein coding
  • Also Known as
    CNG3
  • Product Name
    Cnga3(NM_001282010) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclic nucleotide gated channel alpha 3 (Cnga3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2010
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    CGCUGAAGAAGGUCCGAAUtt

    CGUGAAAGAUGAAGAGUAUtt

    GGAAGUACAUUUACAGUCUtt

  • DataSheet:
  • Product Name
    Cnga3(NM_009918) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclic nucleotide gated channel alpha 3 (Cnga3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1896
  • Annotation
    This variant (2) differs in the 5' UTR and lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) is shorter missing an internal protein segment compared to isoform 1.
  • siRNA

    CGCUGAAGAAGGUCCGAAUtt

    CGUGAAAGAUGAAGAGUAUtt

    GGAAGUACAUUUACAGUCUtt

  • DataSheet:
  • Product Name
    Cnga3(XM_017313748) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus cyclic nucleotide gated channel alpha 3 (Cnga3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1893
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"