NovoPro
Cart 2
  • Cdc7 Mouse  cDNA/ORF Clones

Cdc7 Mouse cDNA/ORF Clones

Cat.#: 767786-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 289.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cell division cycle 7 (S. cerevisiae)
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cdc7
  • Gene Type
    protein coding
  • Also Known as
    Cdc7l1; muCdc7; AI597260
  • Product Name
    Cdc7(XM_006534737) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus cell division cycle 7 (S. cerevisiae) (Cdc7), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1545
  • siRNA
  • DataSheet:
  • Product Name
    Cdc7(NM_001271567) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cell division cycle 7 (S. cerevisiae) (Cdc7), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1599
  • Annotation
    This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2, which is shorter than isoform (1).
  • siRNA

    GAAACGGAUUCAUCAGUUUtt

    CGAGGAUCCAGGGAAACUAtt

    CGACUGCUAUGGAUCAGAUtt

  • DataSheet:
  • Product Name
    Cdc7(XM_017320634) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus cell division cycle 7 (S. cerevisiae) (Cdc7), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1449
  • siRNA
  • DataSheet:
  • Product Name
    Cdc7(NM_001271568) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cell division cycle 7 (S. cerevisiae) (Cdc7), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1578
  • Annotation
    This variant (4) differs in the 5' UTR, lacks an alternate in-frame exon and uses an alternate in-frame acceptor splice site in the coding region compared to variant 1. It encodes isoform 3, which is shorter than isoform (1).
  • siRNA

    GAAACGGAUUCAUCAGUUUtt

    CGAGGAUCCAGGGAAACUAtt

    CGACUGCUAUGGAUCAGAUtt

  • DataSheet:
  • Product Name
    Cdc7(NM_009863) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cell division cycle 7 (S. cerevisiae) (Cdc7), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1695
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1). Both variants 1 and 2 encode the same isoform (1).
  • siRNA

    GAAACGGAUUCAUCAGUUUtt

    CGAGGAUCCAGGGAAACUAtt

    CGACUGCUAUGGAUCAGAUtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"