NovoPro
Cart 2
  • Calr4 Mouse  cDNA/ORF Clone

Calr4 Mouse cDNA/ORF Clone

Cat.#: 767779-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 226.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calreticulin 4
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Calr4
  • Gene Type
    protein coding
  • Also Known as
    AU017583; 4933403L16Rik
  • Product Name
    Calr4(NM_001285895) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calreticulin 4 (Calr4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1320
  • Annotation
    This variant (1) encodes the longest isoform (a).
  • siRNA

    CUCUGAUCCUUCGCCCUAAtt

    GAAUCCCAGUAUUACAUCAtt

    GGAUGAACGACAACAGAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Calr4(NM_001033226) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calreticulin 4 (Calr4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1263
  • Annotation
    This variant (2) has alternate 5' exon structure and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (b) has a distinct and shorter N-terminus, compared to isoform a.
  • siRNA

    CUCUGAUCCUUCGCCCUAAtt

    GAAUCCCAGUAUUACAUCAtt

    GGAUGAACGACAACAGAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Calr4(NM_001285897) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calreticulin 4 (Calr4), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    942
  • Annotation
    This variant (3) has alternate 5' exon structure and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Variants 3, 4 and 5 all encode isoform c.
  • siRNA

    CUCUGAUCCUUCGCCCUAAtt

    GAAUCCCAGUAUUACAUCAtt

    GGAUGAACGACAACAGAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"