NovoPro
Cart 2
  • Cacna2d2 Mouse  cDNA/ORF Clone

Cacna2d2 Mouse cDNA/ORF Clone

Cat.#: 767778-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 833.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium channel, voltage-dependent, alpha 2/delta subunit 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cacna2d2
  • Gene Type
    protein coding
  • Also Known as
    du; td; a2d2; torpid; Cacna2d; mKIAA0558
  • Product Name
    Cacna2d2(NM_001174047) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3471
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    CAGAGACCGAGAUACCGAAtt

    GGAACCUGUUUGAAGUGCAtt

    CGUAGGACAGCAUAACUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna2d2(NM_001174050) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    3447
  • Annotation
    This variant (5) lacks an alternate in-frame exon and uses two alternate in-frame splice sites, compared to variant 1. The resulting isoform (5) differs at three internal regions, compared to isoform 1.
  • siRNA

    CAGAGACCGAGAUACCGAAtt

    GGAACCUGUUUGAAGUGCAtt

    CGUAGGACAGCAUAACUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna2d2(NM_020263) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3465
  • Annotation
    This variant (2) uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (2) lacks a 2-aa internal segment, compared to isoform 1.
  • siRNA

    CAGAGACCGAGAUACCGAAtt

    GGAACCUGUUUGAAGUGCAtt

    CGUAGGACAGCAUAACUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna2d2(NM_001174048) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    3453
  • Annotation
    This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (3) lacks two internal segments, compared to isoform 1.
  • siRNA

    CAGAGACCGAGAUACCGAAtt

    GGAACCUGUUUGAAGUGCAtt

    CGUAGGACAGCAUAACUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    Cacna2d2(NM_001174049) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    3444
  • Annotation
    This variant (4) lacks an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (4) lacks two internal segments, compared to isoform 1.
  • siRNA

    CAGAGACCGAGAUACCGAAtt

    GGAACCUGUUUGAAGUGCAtt

    CGUAGGACAGCAUAACUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"