NovoPro
Cart 2
  • C1qtnf1 Mouse  cDNA/ORF Clones

C1qtnf1 Mouse cDNA/ORF Clones

Cat.#: 767776-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    C1q and tumor necrosis factor related protein 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    C1qtnf1
  • Gene Type
    protein coding
  • Also Known as
    CTRP1; Zsig37; 1600017K21Rik
  • Product Name
    C1qtnf1(NM_019959) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus C1q and tumor necrosis factor related protein 1 (C1qtnf1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    846
  • Annotation
    This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.
  • siRNA

    GAAAGGUGGUGUUAGUUUUtt

    GGCCUGAAGAAACACGAGAtt

    ACUUCUCGGUGCUACCGAUtt

    GAAACACGAGAGAAGUAUAtt

  • DataSheet:
  • Product Name
    C1qtnf1(XM_006533820) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus C1q and tumor necrosis factor related protein 1 (C1qtnf1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    906
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"