NovoPro
Cart 2
  • Astn2 Mouse  cDNA/ORF Clones

Astn2 Mouse cDNA/ORF Clones

Cat.#: 757820-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 971.3 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    astrotactin 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Astn2
  • Gene Type
    protein coding
  • Also Known as
    1d8; Astnl; bM452J22.1
  • Product Name
    Astn2(XM_006538104) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus astrotactin 2 (Astn2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4047
  • siRNA
  • DataSheet:
  • Product Name
    Astn2(NM_207109) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus astrotactin 2 (Astn2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    4059
  • Annotation
    This variant (2) represents the longer transcript and it encodes the longer isoform (b). Isoform b is most similar to the protein encoded by transcript variant 3 of the human gene.
  • siRNA

    GGAGCAAUCUCUAUCGUGUtt

    CAGCCGGUGUUACGACUUUtt

    GCAUCGCGGUACAAGAUGAtt

  • DataSheet:
  • Product Name
    Astn2(XM_006538105) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus astrotactin 2 (Astn2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2865
  • siRNA
  • DataSheet:
  • Product Name
    Astn2(NM_019514) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus astrotactin 2 (Astn2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    3903
  • Annotation
    This variant (1) lacks an alternate segment in the 5' coding region, compared to variant 2. The resulting protein (isoform a) has a shorter N-terminus when compared to isoform b.
  • siRNA

    GGAGCAAUCUCUAUCGUGUtt

    CAGCCGGUGUUACGACUUUtt

    GCAUCGCGGUACAAGAUGAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"