Cart 2
  • Ank3 Mouse  cDNA/ORF Clone

Ank3 Mouse cDNA/ORF Clone

Cat.#: 759961-1

  • Accession#:
  • Vector:
Optional Service:

Special Price Inquiry USD

Availability: Inquiry
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ankyrin 3, epithelial
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ank3
  • Gene Type
    protein coding
  • Also Known as
    AnkG; Ank-3; AI314020; Ankyrin-3; Ankyrin-G; 2900054D09Rik
  • Product Name
    Ank3(NM_146005) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    5886
  • Annotation
    This variant (2) represents the longest transcript and encodes the longest isoform (b).
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170690) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    5823
  • Annotation
    This variant (5) lacks an alternate in-frame exon in the coding region, compared to variant 2. This results in a shorter isoform (e), compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170728) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    5181
  • Annotation
    This variant (1) has multiple differences in the coding region but maintains the reading frame, compared to variant 2. The encoded isoform (a) is shorter, compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170730) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    2517
  • Annotation
    This variant (9) lacks an in-frame segment in the 5' coding region and an in-frame segment in the 3' coding region, compared to variant 2. This results in a shorter isoform (i), compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170687) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    3285
  • Annotation
    This variant (6) utilizes an alternate exon in the 5' coding region and an alternate translation initiation site, compared to variant 2. This results in a shorter isoform (f) and distinct N-terminus, compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170688) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    5298
  • Annotation
    This variant (3) lacks an alternate in-frame segment in the coding region, compared to variant 2. This results in a shorter isoform (c), compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_009670) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    2697
  • Annotation
    This variant (7) utilizes an alternate exon in the 5' coding region and an alternate translation initiation site, compared to variant 2. This results in a shorter isoform (g) and distinct N-terminus, compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170689) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    5832
  • Annotation
    This variant (4) lacks an alternate in-frame exon in the coding region, compared to variant 2. This results in a shorter isoform (d), compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Ank3(NM_170729) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus ankyrin 3, epithelial (Ank3), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    5769
  • Annotation
    This variant (8) has multiple differences in the coding region but maintains the reading frame, compared to variant 2. This results in a shorter isoform (h), compared to isoform b.
  • siRNA

    GUUUGACAGUAAAAACGAAtt

    CCAGCAAGCUUGUCAUAGAtt

    CAGCGGAAGUCAUUCCAGAtt

    GCCCAAUUGUCACGGUAGAtt

    CCGGAAUCCCAAAACGAUAtt

    GCUAUAAGGUGAAGACGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"